Let’s discuss the question: enter the complementary sequence to the dna strand shown.. We summarize all relevant answers in section Q&A of website Myyachtguardian.com in category: Blog MMO. See more related questions in the comments below.
Table of Contents
What is the complementary dna strand for 5?
A always pairs with T and G always pairs with C. Also, it is good to note that the complementary sequence will be going the other way. For example, the original sequence is 5′ to 3′. The complementary sequence will be in 3′ to 5′.
What is the sequence of the complementary strand from 5 to 3?
So, the sequence of the complimentary strand in 5′ to 3′ direction is 5′- GCATGCATGCATGCATGCATGCATGCAT− 3′.
Practice writing the complementary strand of DNA and mRNA during transcription
Images related to the topicPractice writing the complementary strand of DNA and mRNA during transcription
What is complementary sequence of DNA?
Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded structure by matching base pairs. For example, the complementary sequence to C-A-T-G (where each letter stands for one of the bases in DNA) is G-T-A-C.
What should be the complementary strand of 3 Atggcttga 5 ‘?
ATGGCTTGA…. 5′? Explanation: The complementary of A is T and for G is C, therefore the complementary sequence should be …. TACCGAACT….
What is the complementary strand of the given DNA strand?
…
DNA and RNA base pair complementarity.
| Nucleic Acid | Nucleobases | Base complement |
|---|---|---|
| DNA | adenine(A), thymine(T), guanine(G), cytosine(C) | A = T, G ≡ C |
| RNA | adenine(A), uracil(U), guanine(G), cytosine(C) | A = U, G ≡ C |
Sequence of a strand and sequence of complementary strand in DNA
Images related to the topicSequence of a strand and sequence of complementary strand in DNA
What does 5 and 3 mean in DNA?
Each end of DNA molecule has a number. One end is referred to as 5′ (five prime) and the other end is referred to as 3′ (three prime). The 5′ and 3′ designations refer to the number of carbon atom in a deoxyribose sugar molecule to which a phosphate group bonds.
Which of the following sequence is complementary to the leading strand shown above?
Answer: DNA, Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C). Since replication occurs in 5′-3′ direction, so the complementary strand will be formed in 3′-5′ direction. So, the correct answer is 3′-TGACGGATACGA-5′.
Why is the 3/5 strand called the lagging strand?
Leading Strand and Lagging Strand
This is the parent strand of DNA which runs in the 3′ to 5′ direction toward the fork, and it’s replicated continuously by DNA polymerase because DNA polymerase builds a strand that runs antiparallel to it in the 5′ to 3′ direction. The other strand is called the lagging strand.
Complementary Base Pairings | DNA | How to find Complementary Base Pairing for DNA
Images related to the topicComplementary Base Pairings | DNA | How to find Complementary Base Pairing for DNA
What is complimentary DNA sequence for the Strand 5 tcga3 ‘?
If one strand of a DNA molecule has the sequence of bases 5’ATTGCA3′, the other complementary, antiparallel strand of DNA would have the sequence: 5’TGCAAT3′.
How do you write A complementary mRNA sequence?
- Cytosine (C) is replaced with Guanine (G) – and vice versa.
- Uracil (U) is replaced by Adenine (A)
- Adenine (A) is replaced by Thymine (T)
Related searches
- enter the complementary sequence to the dna strand shown 5 gcattcaag 3
- what is the complementary strand of dna sequence
- which of the following single-stranded dna sequences is most likely to form a stem-loop structure?
- what is the complementary dna sequence to atgcttgactg
- how to complementary dna strand
- enter the complementary sequence to the dna strand shown. 5′– atcgaacgt –3′
- what is the complementary sequence on the other dna strand
- identify the key structural features of a dna molecule.
- transcribe the given dna sequences to mrna.
- which of the following single stranded dna sequences is most likely to form a stem loop structure
- what is the complementary sequence to the dna strand
- enter the complementary strand of this dna strand
- enter the complementary sequence to the dna strand shown. 5′– tgacgtgat –3′
- enter the complementary sequence to the dna strand shown 5 tgacgtgat 3
- what is the complementary sequence to the dna strand 5 tacagacag 3
- transcribe the given dna sequences to mrna
- how to get complementary dna sequence
- 5 atcgaacgt 3
- enter the complementary sequence to the dna strand shown. 5′– gcattcaag –3′
- identify the key structural features of a dna molecule
Information related to the topic enter the complementary sequence to the dna strand shown.
Here are the search results of the thread enter the complementary sequence to the dna strand shown. from Bing. You can read more if you want.
You have just come across an article on the topic enter the complementary sequence to the dna strand shown.. If you found this article useful, please share it. Thank you very much.
